Detail of EST/Unigene TCSL77166 |
Acc. | TCSL77166 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 1B, chloroplastic OS=Solanum lycopersicum E-value=0; Chlorophyll a-b binding protein 21, chloroplastic OS=Nicotiana tabacum E-value=0; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=0; Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=0; Chlorophyll a-b binding protein 50, chloroplastic OS=Nicotiana tabacum E-value=0; |
Length | 994 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SL_Lyc_leaf (40 ESTs); SL_CELL_BTI (11 ESTs); SL_RES (9 ESTs); SL_SHOOT_4WEEK (7 ESTs); SL_SUS_LEAF (4 ESTs); SL_Seedlings (2 ESTs); SL_SHOOT_8WEEK (2 ESTs); SL_maturing_fruit (1 ESTs); SL_FLOWER_DEV (1 ESTs); SL_germ_seedlings_TAMU (1 ESTs); |
Sequence | CAACTTCAACAGTATCATCAAACACTTACATTTCTCTTGATATAAACACAATGGCAGCTG |
EST members of Unigene | AW038545 BP896457 BG629835 BP899544 AI483233 BP899156 BP900119 BP904173 AI778134 AW037771 BG126192 BP898408 BP900723 BP901885 AI774425 AW038556 BP898592 AW038762 AI483224 AI772656 BP899338 BP898727 AI773206 BP896992 AW651205 AI772821 CK715161 AW443692 BP905111 BP898933 BG129619 AW092889 BP905514 AW038133 AI772844 BP897598 CK714963 BG642655 BP896407 AW037709 AI782522 BP899462 AI775103 BG123965 BP897151 AI781560 AI772599 BP902956 BP897353 BG129194 BP907406 BP897360 BP908180 BP896397 BP897561 BP902392 BP909539 BP902939 AW039057 BP897908 AW092078 AW038389 BP910211 BG642902 BG125046 AI773866 BP908656 BP905564 BP877191 BP896140 AI779592 AI774886 BP896156 BP897118 BP900591 BP908319 BP900199 BP896913 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 839871 |
Trichome-related Gene from Literature | 839871 |