| Detail of EST/Unigene TCSL77469 |
| Acc. | TCSL77469 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 1B, chloroplastic OS=Solanum lycopersicum E-value=0; Chlorophyll a-b binding protein 21, chloroplastic OS=Nicotiana tabacum E-value=0; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=0; Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=0; Chlorophyll a-b binding protein 50, chloroplastic OS=Nicotiana tabacum E-value=0; |
| Length | 951 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SL_Lyc_leaf (15 ESTs); SL_CELL_BTI (11 ESTs); SL_SHOOT_4WEEK (9 ESTs); SL_RES (4 ESTs); SL_MicroLEAF3 (3 ESTs); SL_FLOWER_DEV (2 ESTs); SL_SUS_LEAF (2 ESTs); SL_SHOOT_8WEEK (1 ESTs); |
| Sequence | CTTTGACATTTCAAACACTCATCACTTTTCTCTTGTTATAAACCATGGCAGCTTCTACAA |
| EST members of Unigene | BP909390 AW093109 AI776742 AW037573 AI781250 BG627334 BG127615 BP900331 BP906712 DB704399 BG124997 BP899532 BP905102 AW093059 DB705251 DB700590 AW038723 BG643032 AW093080 AW093359 AI483211 AI775938 BG128506 BP896676 BG127160 BP902938 BP904097 AW040231 BP901210 BP899662 BP903150 AI782353 BG127075 BP900647 BG123411 AW096279 BG629546 BP902861 BP907110 BG126014 AW092960 BG127964 AI775621 AW037508 AI775432 AW037646 BP896538 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 839871 |
| Trichome-related Gene from Literature | 839871 |