| Detail of EST/Unigene TCSL78156 |
| Acc. | TCSL78156 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Probable rhamnose biosynthetic enzyme 1 OS=Arabidopsis thaliana E-value=9e-94; Probable rhamnose biosynthetic enzyme 3 OS=Arabidopsis thaliana E-value=4e-92; Probable rhamnose biosynthetic enzyme 2 OS=Arabidopsis thaliana E-value=2e-89; Uncharacterized protein L780 OS=Acanthamoeba polyphaga mimivirus E-value=2e-35; |
| Length | 879 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SRR015436 (32 ESTs); SRR015435 (10 ESTs); SL_maturing_fruit (1 ESTs); |
| Sequence | ATTCGAATATGATGCTGCACACCCCGAAGGTTCTGGCATTGGATTCAAAGAGGAAGACAC |
| EST members of Unigene | SRR015436.41083 SRR015435.234435 SRR015436.319146 SRR015436.311382 SRR015436.63234 SRR015436.293300 SRR015436.220250 SRR015436.94982 SRR015436.146053 SRR015436.303767 SRR015435.270885 SRR015436.80046 SRR015436.290402 SRR015436.259806 SRR015436.80034 SRR015436.283631 SRR015436.213894 SRR015436.97195 SRR015436.94818 BP890456 SRR015436.183376 SRR015436.236672 SRR015436.300642 SRR015436.128260 SRR015436.275821 SRR015436.169813 SRR015435.241692 SRR015435.47834 SRR015436.313703 SRR015436.165890 SRR015436.76121 SRR015435.256987 SRR015436.328785 SRR015436.29906 SRR015435.114396 SRR015436.72472 SRR015435.177975 SRR015435.290199 SRR015436.326984 SRR015436.143753 SRR015435.100423 SRR015436.287120 SRR015435.233204 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 844193 |
| Trichome-related Gene from Literature | 844193 |