Detail of EST/Unigene TCSL83369 |
Acc. | TCSL83369 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Metallothionein-like protein type 2 A OS=Solanum lycopersicum E-value=3e-24; Metallothionein-like protein type 2 OS=Solanum lycopersicum E-value=9e-22; Metallothionein-like protein type 2 OS=Nicotiana plumbaginifolia E-value=6e-18; Metallothionein-like protein type 2 OS=Solanum lycopersicum E-value=1e-16; Metallothionein-like protein type 2 OS=Solanum lycopersicum E-value=2e-15; |
Length | 499 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SL_Lyc_leaf (12 ESTs); SL_MicroFRUIT2 (10 ESTs); SRR015435 (6 ESTs); SL_SUS_LEAF (6 ESTs); SL_maturing_fruit (5 ESTs); SL_TAMU (3 ESTs); SL_CELL_BTI (2 ESTs); SL_CDS (2 ESTs); SL_SEED (1 ESTs); SL_ROOT_pre-anthesis (1 ESTs); SL_SHOOT_4WEEK (1 ESTs); SL_radicle (1 ESTs); SL_MicroLEAF3 (1 ESTs); SL_FLOWER_DEV (1 ESTs); SL_MicroFRUIT (1 ESTs); |
Sequence | GATCATAACTACAATAAAAACTTTTTTTTACTCACTAAATTTCCTTTATATCTCAAACAA |
EST members of Unigene | BP903821 TOMMTA BF114139 BP904587 BP902848 BW690896 BW686351 BP904793 BW692102 AI898860 AI779724 BP902872 AI484912 BP902835 BW689242 BW692028 AI780037 AW039112 DB715101 BW692841 BG627108 BP892959 BP892781 AW096563 BP904762 DB679404 BW692518 SRR015435.56446 BP893649 AI487335 AI782725 BP890588 DQ996038 BP903724 AI782734 AI777579 SRR015435.156332 BP897172 BG130167 AW036305 SRR015435.320020 BW685215 BP902497 BW692322 AW626077 AI780906 BP894000 SRR015435.337879 BW687960 SRR015435.83559 BP897685 SRR015435.22041 BP904255 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 831816 |
Trichome-related Gene from Literature | 831816 |