| Detail of EST/Unigene TCSL84414 |
| Acc. | TCSL84414 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Chalcone synthase 1B OS=Solanum tuberosum E-value=1e-17; Chalcone synthase 1A OS=Solanum tuberosum E-value=1e-17; Chalcone synthase 1 OS=Solanum lycopersicum E-value=1e-17; Chalcone synthase 3 OS=Ruta graveolens E-value=6e-17; Chalcone synthase 2 OS=Citrus sinensis E-value=6e-17; |
| Length | 253 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SRR015436 (18 ESTs); SRR015435 (3 ESTs); |
| Sequence | TTTGTTCTGTCTTATTCAAGTTTGAGACTTTTGGATGAAATTCAAGTTTCTTGAAATGGT |
| EST members of Unigene | SRR015436.59925 SRR015436.65881 SRR015435.191877 SRR015436.109165 SRR015436.255432 SRR015436.76746 SRR015436.43167 SRR015436.294214 SRR015436.108134 SRR015436.299401 SRR015436.202950 SRR015436.68941 SRR015436.250695 SRR015436.293851 SRR015435.23000 SRR015436.239032 SRR015436.219977 SRR015435.79487 SRR015436.285835 SRR015436.257732 SRR015436.315395 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 831241 |
| Trichome-related Gene from Literature | 831241 |