| Detail of EST/Unigene TCSL84748 |
| Acc. | TCSL84748 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | 3-ketoacyl-CoA synthase 6 OS=Arabidopsis thaliana E-value=5e-10; 3-ketoacyl-CoA synthase 5 OS=Arabidopsis thaliana E-value=3e-09; |
| Length | 167 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SRR015435 (24 ESTs); |
| Sequence | TAACCGCACAATCAAGACACCAACGGATGGACCATGGGATGATTGCATTGATAGGTACCC |
| EST members of Unigene | SRR015435.246456 SRR015435.257898 SRR015435.507 SRR015435.27750 SRR015435.197150 SRR015435.93720 SRR015435.350361 SRR015435.253276 SRR015435.210580 SRR015435.15552 SRR015435.151089 SRR015435.159169 SRR015435.159936 SRR015435.284683 SRR015435.265127 SRR015435.299416 SRR015435.291669 SRR015435.5838 SRR015435.158665 SRR015435.204420 SRR015435.164912 SRR015435.325451 SRR015435.324875 SRR015435.294285 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 843182 |
| Trichome-related Gene from Literature | 843182 |