Detail of EST/Unigene TCSL84847 |
Acc. | TCSL84847 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Flavonol synthase/flavanone 3-hydroxylase OS=Solanum tuberosum E-value=1e-12; Flavonol synthase/flavanone 3-hydroxylase OS=Eustoma exaltatum subsp. russellianum E-value=5e-11; Flavonol synthase/flavanone 3-hydroxylase OS=Petunia hybrida E-value=1e-10; Flavonol synthase/flavanone 3-hydroxylase OS=Petroselinum crispum E-value=1e-08; Flavonol synthase/flavanone 3-hydroxylase OS=Arabidopsis thaliana E-value=5e-08; |
Length | 152 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SRR015435 (16 ESTs); SRR015436 (4 ESTs); |
Sequence | GTTGGTAAGGAATTTTTTGAAGAAGTAGCACAAGAGGAAAAAGAATTGATTGCAAAGAAG |
EST members of Unigene | SRR015435.298355 SRR015435.182124 SRR015435.131476 SRR015435.242975 SRR015435.214053 SRR015435.180988 SRR015435.275548 SRR015435.143704 SRR015436.34927 SRR015435.21679 SRR015435.159912 SRR015436.8857 SRR015435.71879 SRR015435.263787 SRR015436.226798 SRR015435.49607 SRR015436.173130 SRR015435.116879 SRR015435.144585 SRR015435.184822 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 830765 |
Trichome-related Gene from Literature | 830765 |