| Detail of EST/Unigene TCSL84967 |
| Acc. | TCSL84967 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Protein ABIL1 OS=Arabidopsis thaliana E-value=1e-07; |
| Length | 137 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SRR015435 (4 ESTs); SRR015436 (2 ESTs); |
| Sequence | GCTGGAAAGAAGGTGCACTTCAGCCCTCAAGTTAAGATGGATTCAAGGCAACATTTACAA |
| EST members of Unigene | SRR015436.249548 SRR015435.60163 SRR015435.56648 SRR015436.189598 SRR015435.352774 SRR015435.263402 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 819230 |
| Trichome-related Gene from Literature | 819230 |