| Detail of EST/Unigene TCSL85006 |
| Acc. | TCSL85006 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Flavonol synthase/flavanone 3-hydroxylase OS=Solanum tuberosum E-value=4e-21; Flavonol synthase/flavanone 3-hydroxylase OS=Petunia hybrida E-value=6e-21; Flavonol synthase/flavanone 3-hydroxylase OS=Eustoma exaltatum subsp. russellianum E-value=3e-19; Flavonol synthase/flavanone 3-hydroxylase OS=Citrus unshiu E-value=1e-17; Flavonol synthase/flavanone 3-hydroxylase OS=Arabidopsis thaliana E-value=2e-16; |
| Length | 133 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SRR015435 (12 ESTs); SRR015436 (2 ESTs); |
| Sequence | TGCTTCCCTGTATGAAGGAGGATTTTTTGGCCAATAATGATAGTTAATAGCAGGAGGAGG |
| EST members of Unigene | SRR015435.229354 SRR015435.211284 SRR015435.220821 SRR015435.33960 SRR015435.337545 SRR015435.338746 SRR015436.185120 SRR015435.315599 SRR015435.238767 SRR015435.66260 SRR015435.13242 SRR015435.91274 SRR015436.287736 SRR015435.4737 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 830765 |
| Trichome-related Gene from Literature | 830765 |