| Detail of EST/Unigene TCSL85115 |
| Acc. | TCSL85115 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Hydroxymethylglutaryl-CoA synthase OS=Arabidopsis thaliana E-value=1e-16; Hydroxymethylglutaryl-CoA synthase, cytoplasmic OS=Gallus gallus E-value=5e-13; Hydroxymethylglutaryl-CoA synthase, cytoplasmic OS=Pongo abelii E-value=8e-13; Hydroxymethylglutaryl-CoA synthase, cytoplasmic OS=Mus musculus E-value=8e-13; Hydroxymethylglutaryl-CoA synthase, cytoplasmic OS=Homo sapiens E-value=8e-13; |
| Length | 120 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SRR015435 (7 ESTs); |
| Sequence | TCAACTAATGCCTGTTATGGGGGAACTGCTGCATTGTTCAACTGTGTAAATTGGGTGGAG |
| EST members of Unigene | SRR015435.117533 SRR015435.243736 SRR015435.112794 SRR015435.15017 SRR015435.48236 SRR015435.339945 SRR015435.105787 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00650 Butanoate metabolism > K01641 hydroxymethylglutaryl-CoA synthase; Metabolism > Lipid Metabolism > ko00072 Synthesis and degradation of ketone bodies > K01641 hydroxymethylglutaryl-CoA synthase; Metabolism > Amino Acid Metabolism > ko00280 Valine, leucine and isoleucine degradation > K01641 hydroxymethylglutaryl-CoA synthase |
| EC | 2.3.3.10 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 826788 |
| Trichome-related Gene from Literature | 826788 |