| Detail of EST/Unigene TCSL85199 |
| Acc. | TCSL85199 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Omega-6 fatty acid desaturase, endoplasmic reticulum OS=Brassica juncea E-value=2e-14; Omega-6 fatty acid desaturase, endoplasmic reticulum OS=Arabidopsis thaliana E-value=2e-14; Omega-6 fatty acid desaturase, endoplasmic reticulum isozyme 2 OS=Glycine max E-value=2e-13; Omega-6 fatty acid desaturase, endoplasmic reticulum isozyme 1 OS=Glycine max E-value=1e-12; Delta(12) fatty acid dehydrogenase OS=Crepis alpina E-value=3e-10; |
| Length | 107 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SRR015435 (16 ESTs); SRR015436 (1 ESTs); |
| Sequence | TTGTGGAAGACCTTGTTTAGAACACCATAGTCTCTGTCACAGGTTGCCAAAGCTCCCCTA |
| EST members of Unigene | SRR015435.330539 SRR015435.295264 SRR015435.330186 SRR015435.336203 SRR015435.18833 SRR015435.48572 SRR015435.115833 SRR015435.1652 SRR015435.79528 SRR015435.245067 SRR015435.157495 SRR015435.273661 SRR015435.203627 SRR015436.192882 SRR015435.113943 SRR015435.21240 SRR015435.339995 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 820387 |
| Trichome-related Gene from Literature | 820387 |