Detail of EST/Unigene TCSP50048 |
Acc. | TCSP50048 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Probable mediator of RNA polymerase II transcription subunit 37e OS=Arabidopsis thaliana E-value=0; Probable mediator of RNA polymerase II transcription subunit 37c OS=Arabidopsis thaliana E-value=0; Heat shock cognate 70 kDa protein 2 OS=Solanum lycopersicum E-value=0; Heat shock cognate 70 kDa protein OS=Petunia hybrida E-value=0; Heat shock 70 kDa protein 3 OS=Arabidopsis thaliana E-value=0; |
Length | 908 nt |
Species | Solanum pennellii |
Belonged EST Libraries | SRR027939 (38 ESTs); |
Sequence | TCAGTGGGAATCCCAGAGCTCTTAGGAGATTAAGAACTGCATGTGAAAGAGCTAAGAGAA |
EST members of Unigene | SRR027939.64543 SRR027939.192288 SRR027939.126357 SRR027939.235392 SRR027939.54483 SRR027939.294115 SRR027939.309173 SRR027939.15778 SRR027939.24343 SRR027939.9075 SRR027939.10834 SRR027939.343452 SRR027939.330881 SRR027939.321793 SRR027939.114988 SRR027939.252621 SRR027939.32472 SRR027939.304583 SRR027939.152005 SRR027939.259876 SRR027939.212876 SRR027939.29437 SRR027939.295559 SRR027939.130294 SRR027939.263476 SRR027939.178036 SRR027939.16836 SRR027939.286450 SRR027939.54975 SRR027939.309496 SRR027939.65437 SRR027939.260647 SRR027939.129968 SRR027939.243059 SRR027939.285175 SRR027939.294252 SRR027939.286903 SRR027939.226806 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K03283 heat shock 70kDa protein 1/8 |
EC | |
Transcription Factor Family | |
Transporter Classification Family | 1.A.3 Ryanodine-inositol-1,4,5-trisphosphate receptor Ca2+ channel RIR-CaC; 1.A.33 Cation-channel-forming heat-shock protein 70 Hsp70 |
Probeset |
|
Corresponding NCBI Gene | 831020 |
Trichome-related Gene from Literature | 831020 |