| Detail of EST/Unigene TCSP50532 |
| Acc. | TCSP50532 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Sucrose synthase OS=Solanum tuberosum E-value=0; Sucrose synthase OS=Solanum lycopersicum E-value=0; Sucrose synthase OS=Solanum tuberosum E-value=0; Sucrose synthase isoform 1 OS=Daucus carota E-value=0; Sucrose synthase isoform 2 OS=Daucus carota E-value=0; |
| Length | 1856 nt |
| Species | Solanum pennellii |
| Belonged EST Libraries | SRR027939 (28 ESTs); |
| Sequence | TTAGTAGAATTCCTATGGTTTTCAATGTGGTTATACTTTCACCTCATGGATATTTCGCCC |
| EST members of Unigene | SRR027939.246578 SRR027939.33196 SRR027939.278649 SRR027939.264148 SRR027939.280381 SRR027939.319973 SRR027939.248488 SRR027939.224717 SRR027939.14417 SRR027939.84190 SRR027939.79745 SRR027939.223788 SRR027939.327359 SRR027939.132377 SRR027939.60687 SRR027939.54504 SRR027939.318682 SRR027939.162705 SRR027939.217429 SRR027939.333949 SRR027939.135638 SRR027939.232300 SRR027939.77278 SRR027939.277706 SRR027939.334561 SRR027939.207795 SRR027939.199545 SRR027939.339648 SRR027939.239741 SRR027939.155048 SRR027939.119095 SRR027939.126631 SRR027939.134357 SRR027939.101885 SRR027939.293233 SRR027939.269843 SRR027939.111530 SRR027939.156424 SRR027939.217529 SRR027939.193583 SRR027939.154909 SRR027939.98674 SRR027939.168441 SRR027939.70271 SRR027939.284222 SRR027939.48033 SRR027939.88795 SRR027939.95366 SRR027939.294442 SRR027939.336379 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Glycan Biosynthesis and Metabolism > ko01030 Glycan structures - Biosynthesis 1 > K03843 alpha-1,3/alpha-1,6-mannosyltransferase; Metabolism > Glycan Biosynthesis and Metabolism > ko00510 N-Glycan biosynthesis > K03843 alpha-1,3/alpha-1,6-mannosyltransferase |
| EC | 2.4.1.- 2.4.1.132 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 823393 |
| Trichome-related Gene from Literature | 823393 |