Detail of EST/Unigene TCSP50899 |
Acc. | TCSP50899 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Pyrophosphate-energized vacuolar membrane proton pump OS=Vigna radiata var. radiata E-value=3e-09; Pyrophosphate-energized vacuolar membrane proton pump 1 OS=Arabidopsis thaliana E-value=3e-07; |
Length | 259 nt |
Species | Solanum pennellii |
Belonged EST Libraries | |
Sequence | TGGTCCATTACGGCCGGGGACTGTGAAACCTCACAATTTTTTCATTTATCTTTCTCTCTA |
EST members of Unigene | SRR027939.288102 SRR027939.317683 SRR027939.6328 SRR027939.263415 SRR027939.284865 AW398746 SRR027939.289121 SRR027939.85352 SRR027939.131140 SRR027939.245008 SRR027939.110395 SRR027939.135129 SRR027939.27515 SRR027939.212682 SRR027939.57307 SRR027939.279968 SRR027939.173281 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | 3.A.1 ATP-binding-cassette superfamily ABC ABC-type importers (all from Bacteria and Archaea); 3.A.10 H+-translocating diphosphatase H+-PPase |
Probeset |
|
Corresponding NCBI Gene | 838138 |
Trichome-related Gene from Literature | 838138 |