| Detail of EST/Unigene TCSP51657 |
| Acc. | TCSP51657 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Omega-6 fatty acid desaturase, endoplasmic reticulum isozyme 2 OS=Glycine max E-value=0; Omega-6 fatty acid desaturase, endoplasmic reticulum OS=Arabidopsis thaliana E-value=0; Omega-6 fatty acid desaturase, endoplasmic reticulum OS=Brassica juncea E-value=0; Omega-6 fatty acid desaturase, endoplasmic reticulum isozyme 1 OS=Glycine max E-value=0; Delta(12) fatty acid dehydrogenase OS=Crepis alpina E-value=0; |
| Length | 1441 nt |
| Species | Solanum pennellii |
| Belonged EST Libraries | SRR027939 (37 ESTs); SL_WTP (5 ESTs); |
| Sequence | AAAAAATCAATTTTTCTTTTCATAATAAAATTAAAATATTCTCTCTCTCTTCTTTTTTTT |
| EST members of Unigene | SRR027939.105672 SRR027939.94851 SRR027939.56789 BG138650 SRR027939.108180 SRR027939.221845 SRR027939.119762 SRR027939.56190 SRR027939.281541 SRR027939.156115 SRR027939.60862 SRR027939.59738 SRR027939.90263 SRR027939.79825 SRR027939.187089 SRR027939.245271 SRR027939.285847 BG137842 SRR027939.185535 SRR027939.262260 SRR027939.200941 SRR027939.343751 SRR027939.101338 SRR027939.109069 SRR027939.193729 SRR027939.59595 BG140478 SRR027939.42199 BG138950 SRR027939.118688 SRR027939.70382 SRR027939.235889 SRR027939.264686 SRR027939.278815 SRR027939.270888 SRR027939.173084 BG138114 SRR027939.39155 SRR027939.290401 SRR027939.204204 SRR027939.198406 SRR027939.103489 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | 1.14.19.- |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 820387 |
| Trichome-related Gene from Literature | 820387 |