| Detail of EST/Unigene TCSP51763 |
| Acc. | TCSP51763 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | WRKY transcription factor 6 OS=Arabidopsis thaliana E-value=2e-67; Probable WRKY transcription factor 31 OS=Arabidopsis thaliana E-value=2e-65; Probable WRKY transcription factor 42 OS=Arabidopsis thaliana E-value=2e-64; Probable WRKY transcription factor 47 OS=Arabidopsis thaliana E-value=9e-40; Probable WRKY transcription factor 72 OS=Arabidopsis thaliana E-value=1e-34; |
| Length | 1149 nt |
| Species | Solanum pennellii |
| Belonged EST Libraries | SRR027939 (40 ESTs); SP_TRI (1 ESTs); |
| Sequence | GAAAGCCCAGAATCTGAGAGTTGGGCTCCAAACAAGGCCCCTAAATTGATGACTTCATCA |
| EST members of Unigene | SRR027939.317307 SRR027939.15421 SRR027939.52345 SRR027939.161901 SRR027939.152036 SRR027939.273423 SRR027939.189340 SRR027939.301613 SRR027939.281959 SRR027939.129067 SRR027939.189772 SRR027939.266536 SRR027939.233098 SRR027939.53353 SRR027939.120779 SRR027939.69178 SRR027939.312684 SRR027939.270568 SRR027939.255301 SRR027939.140990 SRR027939.220457 SRR027939.314163 SRR027939.11051 SRR027939.232940 SRR027939.192148 SRR027939.251102 SRR027939.308473 SRR027939.138573 SRR027939.253793 AW399297 SRR027939.206073 SRR027939.102267 SRR027939.90488 SRR027939.37995 SRR027939.40696 SRR027939.56541 SRR027939.159321 SRR027939.75841 SRR027939.30803 SRR027939.39108 SRR027939.196036 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | WRKY |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 842527 |
| Trichome-related Gene from Literature | 842527 |