| Detail of EST/Unigene TCSP51921 |
| Acc. | TCSP51921 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase, chloroplastic OS=Catharanthus roseus E-value=2e-85; 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase, chloroplastic OS=Arabidopsis thaliana E-value=5e-83; 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase, chloroplastic OS=Oryza sativa subsp. japonica E-value=1e-81; Bifunctional enzyme IspD/IspF OS=Erythrobacter litoralis (strain HTCC2594) E-value=4e-41; 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase OS=Thioalkalivibrio sp. (strain HL-EbGR7) E-value=5e-41; |
| Length | 955 nt |
| Species | Solanum pennellii |
| Belonged EST Libraries | SRR027939 (29 ESTs); LIBEST_025262 (1 ESTs); |
| Sequence | GGCCATTACGGCCGGGGCTACGAAAAGATTGGAATTTCCCTTCAATTTACACAAGTTCTT |
| EST members of Unigene | SRR027939.100258 SRR027939.173316 SRR027939.192255 SRR027939.298738 SRR027939.87686 SRR027939.184107 SRR027939.166359 SRR027939.200014 SRR027939.4609 SRR027939.14279 SRR027939.212207 GT158333 SRR027939.46004 SRR027939.36934 SRR027939.2999 SRR027939.239200 SRR027939.47393 SRR027939.113473 SRR027939.300565 SRR027939.254222 SRR027939.33886 SRR027939.189470 SRR027939.85489 SRR027939.274907 SRR027939.117206 SRR027939.106188 SRR027939.229133 SRR027939.17090 SRR027939.286506 SRR027939.73128 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 842700 |
| Trichome-related Gene from Literature | 842700 |