| Detail of EST/Unigene TCSP52063 |
| Acc. | TCSP52063 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Probable rhamnose biosynthetic enzyme 1 OS=Arabidopsis thaliana E-value=1e-29; Probable rhamnose biosynthetic enzyme 2 OS=Arabidopsis thaliana E-value=2e-29; Probable rhamnose biosynthetic enzyme 3 OS=Arabidopsis thaliana E-value=3e-29; dTDP-D-glucose 4,6-dehydratase OS=Dictyostelium discoideum E-value=1e-11; Uncharacterized protein PB2B2.11 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=1e-11; |
| Length | 858 nt |
| Species | Solanum pennellii |
| Belonged EST Libraries | SRR027939 (29 ESTs); |
| Sequence | CATTGTTCCCTCTAGTGGTGATAACAGGCAATCCATATGATCTTGCATATGCCATAACAA |
| EST members of Unigene | SRR027939.48886 SRR027939.189374 SRR027939.145284 SRR027939.16366 SRR027939.106805 SRR027939.171208 SRR027939.39603 SRR027939.115541 SRR027939.23381 SRR027939.287007 SRR027939.78083 SRR027939.338414 SRR027939.222290 SRR027939.74329 SRR027939.338333 SRR027939.22523 SRR027939.96068 SRR027939.275438 SRR027939.78309 SRR027939.258074 SRR027939.189452 SRR027939.17826 SRR027939.252280 SRR027939.114460 SRR027939.147310 SRR027939.341561 SRR027939.280133 SRR027939.213656 SRR027939.41453 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00521 Streptomycin biosynthesis > K01710 dTDP-glucose 4,6-dehydratase; Metabolism > Carbohydrate Metabolism > ko00520 Nucleotide sugars metabolism > K01710 dTDP-glucose 4,6-dehydratase; Metabolism > Biosynthesis of Polyketides and Nonribosomal Peptides > ko01055 Biosynthesis of vancomycin group antibiotics > K01710 dTDP-glucose 4,6-dehydratase; Metabolism > Biosynthesis of Polyketides and Nonribosomal Peptides > ko00523 Polyketide sugar unit biosynthesis > K01710 dTDP-glucose 4,6-dehydratase |
| EC | 4.2.1.46 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 844193 |
| Trichome-related Gene from Literature | 844193 |