Detail of EST/Unigene TCSP52213 |
Acc. | TCSP52213 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Sucrose transport protein SUC1 OS=Arabidopsis thaliana E-value=6e-76; Sucrose transport protein SUC2 OS=Arabidopsis thaliana E-value=4e-75; Sucrose transport protein OS=Spinacia oleracea E-value=6e-75; Sucrose transport protein SUC5 OS=Arabidopsis thaliana E-value=9e-69; Putative sucrose transport protein SUC6 OS=Arabidopsis thaliana E-value=3e-65; |
Length | 786 nt |
Species | Solanum pennellii |
Belonged EST Libraries | SRR027939 (40 ESTs); SP_TRI (1 ESTs); |
Sequence | AGTACCGTTTTCGGTGAAATTTTTGGGGCTTTGAAAGATTTACCTAGACCCATGTGGATT |
EST members of Unigene | SRR027939.341829 SRR027939.152022 SRR027939.308185 SRR027939.311082 SRR027939.339497 SRR027939.136739 SRR027939.244033 SRR027939.97117 SRR027939.117056 SRR027939.3998 SRR027939.331401 SRR027939.144561 SRR027939.39449 SRR027939.43120 SRR027939.230768 SRR027939.115744 SRR027939.250657 SRR027939.7117 SRR027939.316332 SRR027939.4540 AW399018 SRR027939.115085 SRR027939.122556 SRR027939.87387 SRR027939.207033 SRR027939.12201 SRR027939.52992 SRR027939.301132 SRR027939.291670 SRR027939.233700 SRR027939.265023 SRR027939.50501 SRR027939.14745 SRR027939.299068 SRR027939.45708 SRR027939.336557 SRR027939.135345 SRR027939.266987 SRR027939.73702 SRR027939.291137 SRR027939.17843 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | 2.A.2 Glycoside/pentoside/hexuronide,cation symporter GPH |
Probeset |
|
Corresponding NCBI Gene | 843519 |
Trichome-related Gene from Literature | 843519 |