Detail of EST/Unigene TCSP52604 |
Acc. | TCSP52604 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Gamma-glutamyltranspeptidase 1 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=2e-37; Gamma-glutamyltranspeptidase 1 OS=Rattus norvegicus E-value=8e-37; Gamma-glutamyltranspeptidase 1 OS=Mus musculus E-value=3e-36; Gamma-glutamyltranspeptidase 2 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=4e-35; Gamma-glutamyltranspeptidase 1 OS=Sus scrofa E-value=5e-32; |
Length | 652 nt |
Species | Solanum pennellii |
Belonged EST Libraries | SRR027939 (7 ESTs); SP_TRI (1 ESTs); |
Sequence | ACATTGGTGTATGGCTAATTGGAGATGTAAATAGTAGTAGATATAATGGAAAACTAGAGC |
EST members of Unigene | SRR027939.4642 AW399150 SRR027939.131366 SRR027939.209272 SRR027939.63292 SRR027939.182709 SRR027939.36752 SRR027939.53370 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K00681 gamma-glutamyltranspeptidase; Metabolism > Metabolism of Other Amino Acids > ko00460 Cyanoamino acid metabolism > K00681 gamma-glutamyltranspeptidase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00681 gamma-glutamyltranspeptidase; Metabolism > Metabolism of Other Amino Acids > ko00450 Selenoamino acid metabolism > K00681 gamma-glutamyltranspeptidase; Metabolism > Metabolism of Other Amino Acids > ko00430 Taurine and hypotaurine metabolism > K00681 gamma-glutamyltranspeptidase |
EC | 2.3.2.2 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 829042 |
Trichome-related Gene from Literature | 829042 |