| Detail of EST/Unigene TCSP53346 |
| Acc. | TCSP53346 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | 3-ketoacyl-CoA synthase 6 OS=Arabidopsis thaliana E-value=3e-48; 3-ketoacyl-CoA synthase 5 OS=Arabidopsis thaliana E-value=1e-46; 3-ketoacyl-CoA synthase 9 OS=Arabidopsis thaliana E-value=9e-40; 3-ketoacyl-CoA synthase 4 OS=Arabidopsis thaliana E-value=1e-39; Probable 3-ketoacyl-CoA synthase 2 OS=Arabidopsis thaliana E-value=7e-38; |
| Length | 484 nt |
| Species | Solanum pennellii |
| Belonged EST Libraries | SRR027939 (21 ESTs); |
| Sequence | ACACGCTGGAGGAAGGGCGCTAATAGATGAACTACAGAACAACTTACAACTATCGACGGA |
| EST members of Unigene | SRR027939.208663 SRR027939.184115 SRR027939.19261 SRR027939.120158 SRR027939.275777 SRR027939.228259 SRR027939.141449 SRR027939.51232 SRR027939.170853 SRR027939.342944 SRR027939.49762 SRR027939.279351 SRR027939.49893 SRR027939.31909 SRR027939.320841 SRR027939.123530 SRR027939.73677 SRR027939.121020 SRR027939.176119 SRR027939.71557 SRR027939.250168 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 843182 |
| Trichome-related Gene from Literature | 843182 |