| Detail of EST/Unigene TCSP54093 |
| Acc. | TCSP54093 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Probable rhamnose biosynthetic enzyme 1 OS=Arabidopsis thaliana E-value=1e-37; Probable rhamnose biosynthetic enzyme 2 OS=Arabidopsis thaliana E-value=1e-36; Probable rhamnose biosynthetic enzyme 3 OS=Arabidopsis thaliana E-value=2e-35; Uncharacterized protein L780 OS=Acanthamoeba polyphaga mimivirus E-value=2e-06; |
| Length | 371 nt |
| Species | Solanum pennellii |
| Belonged EST Libraries | SRR027939 (17 ESTs); |
| Sequence | CGTCAGGGTACCGACCACATTAGCTCTGATGGTCTCCACCTTATGGGATTCACACCAGTC |
| EST members of Unigene | SRR027939.313417 SRR027939.331204 SRR027939.192648 SRR027939.191296 SRR027939.273841 SRR027939.146647 SRR027939.150516 SRR027939.24672 SRR027939.277082 SRR027939.11516 SRR027939.56849 SRR027939.118104 SRR027939.64780 SRR027939.136689 SRR027939.143465 SRR027939.151007 SRR027939.13828 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 844193 |
| Trichome-related Gene from Literature | 844193 |