Detail of EST/Unigene TCSP54093 |
Acc. | TCSP54093 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Probable rhamnose biosynthetic enzyme 1 OS=Arabidopsis thaliana E-value=1e-37; Probable rhamnose biosynthetic enzyme 2 OS=Arabidopsis thaliana E-value=1e-36; Probable rhamnose biosynthetic enzyme 3 OS=Arabidopsis thaliana E-value=2e-35; Uncharacterized protein L780 OS=Acanthamoeba polyphaga mimivirus E-value=2e-06; |
Length | 371 nt |
Species | Solanum pennellii |
Belonged EST Libraries | SRR027939 (17 ESTs); |
Sequence | CGTCAGGGTACCGACCACATTAGCTCTGATGGTCTCCACCTTATGGGATTCACACCAGTC |
EST members of Unigene | SRR027939.313417 SRR027939.331204 SRR027939.192648 SRR027939.191296 SRR027939.273841 SRR027939.146647 SRR027939.150516 SRR027939.24672 SRR027939.277082 SRR027939.11516 SRR027939.56849 SRR027939.118104 SRR027939.64780 SRR027939.136689 SRR027939.143465 SRR027939.151007 SRR027939.13828 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 844193 |
Trichome-related Gene from Literature | 844193 |