| Detail of EST/Unigene TOBGL153A |
| Acc. | TOBGL153A |
| Internal Acc. | |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase, acidic isoform GL153 OS=Nicotiana tabacum E-value=0; Glucan endo-1,3-beta-glucosidase, acidic isoform GL161 OS=Nicotiana tabacum E-value=0; Glucan endo-1,3-beta-glucosidase OS=Nicotiana tabacum E-value=0; Glucan endo-1,3-beta-glucosidase OS=Nicotiana tabacum E-value=0; Glucan endo-1,3-beta-glucosidase, acidic isoform GI9 OS=Nicotiana tabacum E-value=0; |
| Length | 1201 nt |
| Species | Nicotiana tabacum |
| Belonged EST Libraries | MT_CDS; |
| Sequence | GAAACTTCTCTCATTTCCATTTTAGCTATGGCTTTGTGCATTAAAAATGGCTTTCTTGCG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 827320 |
| Trichome-related Gene from Literature | N/A |