Detail of EST/Unigene TOBPRNA |
Acc. | TOBPRNA |
Internal Acc. | |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase, acidic isoform PR-N (Fragment) OS=Nicotiana tabacum E-value=0; Glucan endo-1,3-beta-glucosidase, acidic isoform GI9 OS=Nicotiana tabacum E-value=0; Glucan endo-1,3-beta-glucosidase, acidic isoform GL153 OS=Nicotiana tabacum E-value=0; Glucan endo-1,3-beta-glucosidase, acidic isoform GL161 OS=Nicotiana tabacum E-value=0; Glucan endo-1,3-beta-glucosidase OS=Nicotiana tabacum E-value=0; |
Length | 966 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | MT_CDS; |
Sequence | AATGTCTTCAACGCTCTCAGAGGAAGTAACATTGAGATCATTCTCGACGTCCCACTTCAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 827320 |
Trichome-related Gene from Literature | N/A |