Location:
EST Analysis
> EST Library Details
| Library Acc. |
MT_NOD_NOLLY |
| Name |
Medicago truncatula root nodule (NOLLY) |
| Organism |
Medicago truncatula |
| Tissue |
root nodule |
| Stage |
young, developing, 4 to 8 days post infection with Sinorhizobium meliloti strain Sm41 |
| Description |
Organ: root nodule; Vector: Lambda HybriZAP; Site_1: EcoRI; Site_2: XhoI |
| # of EST/cDNA |
3074 |
| # of Unigene |
2360;
Of them, 773 singletons and 1587 TCs.
|
| Download (.zip) |
link |
| Release Date |
Mar 09, 2006 |
| Contact |
Mergaert P Institut des Sciences du Vegetal (ISV) Centre National de la Recherche Scientifique (CNRS) Av. de la Terrasse Bat. 23, 91198 Gif-sur-Yvette, France Tel: 00 33 (0)1 69 82 37 90 Fax: 00 33 (0)1 69 82 36 95 Email: peter.mergaert@isv.cnrs-gif.fr PCR PRimers FORWARD: ATTCGATGATGAAGATACCCC BACKWARD: GTAATACGACTCACTATAGGG Seq primer: ATTCGATGATGAAGATACCCC. |
| Citation |
Expressed sequence tags from Medicago truncatula R108 young nodule library
Maunoury,N., Redondo-Nieto,M., Vaubert,D., Horvath,G., Mergaert,P. and Kondorosi,E.
Unpublished (2006)
|
|
