Location:
EST Analysis
> EST Library Details
| Library Acc. |
MTAPHEU |
| Name |
Medicago truncatula root, inoculation with A. euteiches zoospores |
| Organism |
Medicago truncatula |
| Tissue |
root |
| Stage |
6 days afer inoculation with Aphanomyces euteiches zoospores |
| Description |
Vector: pGEM-T; Site_1: EcoRI; genotype A17; Total RNA was isolated from roots harvested 6 days after inoculation with Aphanomyces euteiches zoospores. cDNA was prepared from total RNA using the SMART PCR cDNA system (Clontech). This cDNA was used as tester in Suppression Substractive Hybridization (SSH). The SSH-cDNA fragments were generated using the SSH-adaptor sequences ctaatacgactcactatagggctcgagcggccgcccgggcaggt and ctaatacgactcactatagggcagcgtggtcgcggccgaggt (Clontech) and ligated after Suppression Subtractive Hybridization into the pGEM-Teasy vector (Promega). Plasmids containing cDNA inserts were propagated in E. coli TOP 10F' cells (InVitrogen). |
| # of EST/cDNA |
479 |
| # of Unigene |
350;
Of them, 69 singletons and 281 TCs.
|
| Download (.zip) |
link |
| Release Date |
Dec 11, 2003 |
| Contact |
Krajinski F LG Molekulargenetik Herrenhaeuser Str. 2 D-30419 Hannover, Germany. |
| Citation |
Transcriptional profiling of Medicago truncatula roots after infection with Aphanomyces euteiches (oomycota) identifies novel genes upregulated during this pathogenic interaction
Nyamsuren,O., Colditz,F., Rosendahl,S., Tamasloukht,M., Bekel,T., Meyer,F., Kuester,H., Franken,P. and Krajinski,F.
Physiol. Mol. Plant Pathol. 63 (1), 17-26 (2003)
|
|