Location:
EST Analysis
> EST Library Details
| Library Acc. |
MTAMP |
| Name |
Medicago truncatula, mycorrhizal roots |
| Organism |
Medicago truncatula |
| Tissue |
mycorrhizal roots |
| Stage |
six week old mycorrhizal roots harvested five weeks after inoculation with Glomus intraradices |
| Description |
Vector: pGEM-T; Site_1: PstI; Site_2: SphI; genotype A17; cDNA was prepared from polyA+ enriched RNA from mycorrhizal roots harvested five weeks after inoculation. The cDNA was directionally ligated by MediGenomix into the pGEM-T vector from Promega using GCATGCGGCCGAGGCGGCCGACATG and CTGCAGGCCATTATGGCCGGG adapters. Plasmids containing cDNA inserts were propagated in E. coli DH10B cells. |
| # of EST/cDNA |
3450 |
| # of Unigene |
2145;
Of them, 286 singletons and 1859 TCs.
|
| Download (.zip) |
link |
| Release Date |
Feb 10, 2003 |
| Contact |
Kuester H Lehrstuhl fuer Genetik Universitaet Bielefeld Postfach 100131, D-33501 Bielefeld, Germany. |
| Citation |
Detection of transcript sequences from mycorrhizal roots of the model mycorrhiza Medicago truncatula genotype A17 - Glomus intraradices using the approach of an EST genome project
Manthey,K., Bartelsmeier,V., Baier,M.C., Meyer,F., Bartels,D., Bekel,T., Linke,B., Grunwald,U., Franken,P., Kuester,H., Perlick,A.M. and Puehler,A.
Unpublished (2002)
|
|
