Location:
EST Analysis
> EST Library Details
| Library Acc. |
MTGIM |
| Name |
Medicago truncatula, mycorrhizal roots |
| Organism |
Medicago truncatula |
| Tissue |
mycorrhizal roots |
| Stage |
3 weeks after inoculation |
| Description |
Vector: pGEM-Teasy; genotype A17; cDNA was prepared from total RNA using the SMART PCR cDNA system (Clontech) from roots harvested three weeks after inoculation with Glomus intraradices. This cDNA was used as tester in a Suppression Subtractive Hybridization (SSH). The SSH-cDNA fragments were generated using the SSH-adaptor sequences ctaatacgactcactatagggctcgagcggccgcccgggcaggt and ctaatacgactcactatagggcagcgtggtcgcggccgaggt (Clontech) and ligated after Suppression Subtractive Hybridization in to the pGEM-Teasy vector from Promega. Plasmids containing cDNA inserts were propagated in E. coli TOP 10F' cells (Invitrogen) |
| # of EST/cDNA |
1689 |
| # of Unigene |
803;
Of them, 191 singletons and 612 TCs.
|
| Download (.zip) |
link |
| Release Date |
Aug 19, 2003 |
| Contact |
Krajinski F LG Molekulargenetik Herrenhaeuser Str. 2 D-30419 Hannover, Germany. |
| Citation |
Transcriptional changes in response to arbuscular mycorrhiza development in the model plant Medicago truncatula
Wulf,A., Manthey,K., Doll,J., Perlick,A.M., Linke,B., Bekel,T., Meyer,F., Franken,P., Kuster,H. and Krajinski,F.
Mol. Plant Microbe Interact. 16 (4), 306-314 (2003) PUBMED 12744459
|
|
