Location:
EST Analysis
> EST Library Details
| Library Acc. |
MtSNF |
| Name |
Medicago truncatula, whole roots |
| Organism |
Medicago truncatula |
| Tissue |
whole roots |
| Stage |
14 days old roots nitrogen starved for 4 days and 10-8M NodSm factor treated |
| Description |
Vector: pGEM-T; The SSH-cDNA fragments were generated using the SSH-adaptor sequences ctaatacgactcactatagggctcgagcggccgcccgggcaggt and ctaatacgactcactatagggcagcgtggtcgcggccgaggt |
| # of EST/cDNA |
718 |
| # of Unigene |
493;
Of them, 123 singletons and 370 TCs.
|
| Download (.zip) |
link |
| Release Date |
Dec 15, 2004 |
| Contact |
Gouzy J LIPM, CNRS/INRA BP 27 Chemin de Borde Rouge, 31326 Castanet Cedex, FRANCE. |
| Citation |
Identification of potential regulators of the Medicago truncatula - Sinorhizobium meliloti symbiosis with Suppression Subtractive Hybridization libraries
Godiard,L., Niebel,A., Micheli,F., Gouzy,J. and Gamas,P.
Unpublished (204)
|
|
