Location:
EST Analysis
> EST Library Details
| Library Acc. |
MTPOSE |
| Name |
Medicago truncatula, pods including seeds |
| Organism |
Medicago truncatula |
| Tissue |
pods including seeds |
| Stage |
different stages of development |
| Description |
Vector: pGEM-T; Site_1: PstI; Site_2: SphI; genotype A17; cDNA was prepared from polyA+ enriched RNA from developing pods including seeds harvested at different stages of development. The cDNA was directionally ligated by MediGenomix into the pGEM-T vector from Promega using GCATGCGGCCGAGGCGGCCGACATG and CTGCAGGCCATTATGGCCGGG adapters. Plasmids containing cDNA inserts were propagated in E. coli DH10B cells. |
| # of EST/cDNA |
1162 |
| # of Unigene |
836;
Of them, 69 singletons and 767 TCs.
|
| Download (.zip) |
link |
| Release Date |
Aug 29, 2002 |
| Contact |
Kuester H Lehrstuhl fuer Genetik Universitaet Bielefeld Postfach 100131, D-33501 Bielefeld, Germany. |
| Citation |
Determination of transcript sequences from developing pods including seeds of Medicago truncatula genotype A17
Firnhaber,C., Bartelsmeier,V., Meyer,F., Bartels,D., Bekel,T., Linke,B., Puehler,A. and Kuester,H.
Unpublished (2002)
|
|
