| Detail of Probeset 245118_at in Chip ATH1 |
| Probeset ID |
245118_at |
| Species |
Arabidopsis thaliana |
| Annotation |
putative thioredoxin reductase The last 2 exons encode thioredoxin. There is an EST match to exons 5-7, and the distance between exon 7 and exon 8 is only 90bp. It is unlikely this is two separate genes, but more likely a hybrid protein.; supported by cD |
| Mapped public sequence ID |
At2g41680 |
| Gene Ontology |
|
| KEGG |
|
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
N/A |
| Target sequence |
ggccaagtcgaactcgacagctccgggtacgtcttggttcgggaaggaacatcaaataca
tcagttgaaggtgtatttgctgcaggagatgtgcaggaccacgaatggagacaagctgta
actgctgctggatcaggatgcatagctgctttgtcagccgagagatacctcacaagtaac
aatcttcttgttgaatttcaccagcctcaaactgaagaggccaagaaagaattcacacaa
cgggatgtccaagaa |
