| Detail of Probeset 245702_at in Chip ATH1 | |
| Probeset ID | 245702_at |
| Species | Arabidopsis thaliana |
| Annotation | calcium lipid binding protein - like GC donor splice site at exon 3; supported by cDNA: gi_16604592_gb_AY059741.1_ |
| Mapped public sequence ID | At5g04220 |
| Gene Ontology | |
| KEGG | |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | N/A |
| Target sequence | ggaatgcagatgatccctttgcaaaagattaacccgggtgagaggaaggagtttaatctt |