| Detail of Probeset 246207_at in Chip ATH1 | |
| Probeset ID | 246207_at |
| Species | Arabidopsis thaliana |
| Annotation | RNA-binding like protein non-consensus TA donor splice site at exon 6; supported by cDNA: gi_15081786_gb_AY048286.1_ |
| Mapped public sequence ID | At4g36960 |
| Gene Ontology | |
| KEGG | |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | N/A |
| Target sequence | gcccacccgtggctattgcaggtggatttggagctccaggtggttatggagcttatgatg |