| Detail of Probeset 248379_at in Chip ATH1 | |
| Probeset ID | 248379_at |
| Species | Arabidopsis thaliana |
| Annotation | RAR1 (gb|AAF18433.1) non-consensus GT acceptor splice site at exon 2; supported by full-length cDNA: Ceres: 99615. |
| Mapped public sequence ID | At5g51700 |
| Gene Ontology | |
| KEGG | |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | N/A |
| Target sequence | ggttcttgtcaatttcatgcttccgtacccattttttcacgacggaatgaaagagtggag |