| Detail of Probeset 248681_at in Chip ATH1 | |
| Probeset ID | 248681_at |
| Species | Arabidopsis thaliana |
| Annotation | pectate lyase non-consensus AG donor splice site at exon 2; supported by full-length cDNA: Ceres: 21311. |
| Mapped public sequence ID | At5g48900 |
| Gene Ontology | |
| KEGG | |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | N/A |
| Target sequence | tgctgttatggcttctactgctattactatctccaataattacttcacacaccacaatga |