| Detail of Probeset 251155_at in Chip ATH1 |
| Probeset ID |
251155_at |
| Species |
Arabidopsis thaliana |
| Annotation |
putative protein outer envelope membrane protein E 6.7 - chloroplast Spinacia oleracea, PIR:A35958; supported by cDNA: gi_15724349_gb_AF412115.1_AF412115 |
| Mapped public sequence ID |
At3g63160 |
| Gene Ontology |
|
| KEGG |
|
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
N/A |
| Target sequence |
ggtggagaagtcaggaggagaagtcaatttcccaaaattggagaaaccaacaggcaagaa
acagacagcgacggttgttgtgggagtgttggcggtgggatggctggcgatagagctcgt
gtttaagccattgttcaagaagctgagctcctccaaggacaaatccgattccgacgat |
