| Detail of Probeset 251486_at in Chip ATH1 |
| Probeset ID |
251486_at |
| Species |
Arabidopsis thaliana |
| Annotation |
60S RIBOSOMAL PROTEIN L38-like protein 60S RIBOSOMAL PROTEIN L38 - Lycopersicon esculentum, EMBL:X69979; supported by cDNA: gi_13605719_gb_AF361841.1_AF361841 |
| Mapped public sequence ID |
At3g59540 |
| Gene Ontology |
|
| KEGG |
|
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
N/A |
| Target sequence |
atgccgaagcaaatccatgagatcaaggacttccttttgacggcgagaaggaaggatgca
aggtctgtgaagatcaagagaagcaaggacattgtgaagttcaaggtcaggtgctcaagg
tacctctacacactatgtgtcttcgaccaagagaaggccgataagttgaagcagtctct |
