Detail of Probeset 252324_at in Chip ATH1
Probeset ID 252324_at
Species Arabidopsis thaliana
Annotation protein translocation complex sec61 gamma chain-like protein protein translocation complex sec61 gamma chain, endoplasmic reticulum - Canis lupus familiaris,PIR2:S42412; supported by full-length cDNA: Ceres: 14692.
Mapped public sequence ID At3g48565
Gene Ontology
KEGG
Transporter
Transcription Factor
Mapped unigene in the TRICHOME database N/A
Target sequence gaggagaagaacgaaccaaacgacattatcagccctttgaggaagctcttagttttgtta
ttgtttttgtagccaaattctccattcttattccattttcacttatctcttgt