| Detail of Probeset 255079_s_at in Chip ATH1 |
| Probeset ID |
255079_s_at |
| Species |
Arabidopsis thaliana |
| Annotation |
14-3-3 protein GF14chi (grf1) identical to 14-3-3 protein GF14 chi chain GI:1702986, SP:P42643 from [Arabidopsis thaliana]; supported by full-length cDNA: Ceres: 21771. |
| Mapped public sequence ID |
At4g09000 |
| Gene Ontology |
|
| KEGG |
|
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
N/A |
| Target sequence |
tccaacgcatccgattcgtcttggtcttgcgttgaacttctctgtgttttactatgagat
tctcaattctccagatcgtgcttgtaatctcgctaagcaggcgtttgat |
