| Detail of Probeset 255431_at in Chip ATH1 | |
| Probeset ID | 255431_at |
| Species | Arabidopsis thaliana |
| Annotation | putative C-type U1 snRNP similar to U1 small nuclear ribonucleoprotein C;supported by full-length cDNA: Ceres:20753. |
| Mapped public sequence ID | At4g03120 |
| Gene Ontology | |
| KEGG | |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | N/A |
| Target sequence | tgcgatacttatctcactcacgattccccatcagtaaggaagcagcacaatgctggttac |