| Detail of Probeset 255644_at in Chip ATH1 | |
| Probeset ID | 255644_at |
| Species | Arabidopsis thaliana |
| Annotation | coded for by A. thaliana cDNA T43872 similar to the myc family of helix-loop-helix transcription factors |
| Mapped public sequence ID | At4g00870 |
| Gene Ontology | |
| KEGG | |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | N/A |
| Target sequence | acaagggtagctgcggcgacgaaagagaaacatcatccggcggttttgtcccacgtggaa |