| Detail of Probeset 256184_at in Chip ATH1 | |
| Probeset ID | 256184_at |
| Species | Arabidopsis thaliana |
| Annotation | epsilon subunit of mitochondrial F1-ATPase identical to epsilon subunit of mitochondrial F1-ATPase [Arabidopsis thaliana] GI:1655486; supported by cDNA: gi_1655485_dbj_D88377.1_D88377 |
| Mapped public sequence ID | At1g51650 |
| Gene Ontology | |
| KEGG | |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | N/A |
| Target sequence | ttccgttctggagagcggcggggatgacatatatatcgtattcaaacatctgtgcgaata |