| Detail of Probeset 256394_at in Chip ATH1 | |
| Probeset ID | 256394_at |
| Species | Arabidopsis thaliana |
| Annotation | unknown protein contains non-consensus donor splice site TT at exon 11 and CT at exon 13 |
| Mapped public sequence ID | At3g06290 |
| Gene Ontology | |
| KEGG | |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | N/A |
| Target sequence | agactcgaactccataactcaagccgctaccatatcaccccgagatggattggtatcttc |