| Detail of Probeset 256417_s_at in Chip ATH1 |
| Probeset ID |
256417_s_at |
| Species |
Arabidopsis thaliana |
| Annotation |
omega-3 fatty acid desaturase, chloroplast precursor identical to omega-3 fatty acid desaturase, chloroplast precursor SP:P46310 (Arabidopsis thaliana (Mouse-ear cress)); supported by cDNA: gi_14488093_gb_AF389295.1_AF389295 |
| Mapped public sequence ID |
At3g11170 |
| Gene Ontology |
|
| KEGG |
|
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
N/A |
| Target sequence |
ggaactcatgtgatacatcatcttttcccgcagatcccacattatcatctagtagaagca
acagaagcagctaaaccagta |
