| Detail of Probeset 257738_at in Chip ATH1 |
| Probeset ID |
257738_at |
| Species |
Arabidopsis thaliana |
| Annotation |
40S ribosomal subunit protein S21, putative similar to 40S ribosomal subunit protein S21 GB:CAA70852 [Zea mays]; contains Pfam profile: PF01249 ribosomal protein S21e; can not identify a start codon for an ORF |
| Mapped public sequence ID |
At3g27450 |
| Gene Ontology |
|
| KEGG |
|
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
N/A |
| Target sequence |
atgaatttaccgaacattcctcgacaatccatgcatatacgctcaactactaacagattt
atcacatcaaaggatcatgcttcagtgcagctcaacattggtcatcttgatgctaatgga
ctctacactggtcaattcactacctttgctctctgcggttttgtccgtgctcagggtgat
gcggacagtggagtcgataggctaaggc |
