| Detail of Probeset 257763_s_at in Chip ATH1 |
| Probeset ID |
257763_s_at |
| Species |
Arabidopsis thaliana |
| Annotation |
disease resistance protein, putative similar to Hcr2-5b GB:AAC78595 [Lycopersicon esculentum] (Plant Cell 10, 1915-1926 (1998)); contains Pfam profile: PF00560 leucine rich repeat (20 copies) |
| Mapped public sequence ID |
At3g23110 |
| Gene Ontology |
|
| KEGG |
|
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
N/A |
| Target sequence |
ttaaagtcatagatttttctggaaaccgattctctggacatatccctagatccattggtc
tattgagcgaattgcttcatctcaacttgtc |
