| Detail of Probeset 258586_s_at in Chip ATH1 | |
| Probeset ID | 258586_s_at |
| Species | Arabidopsis thaliana |
| Annotation | putative trypsin inhibitor similar to trypsin inhibitor:ISOTYPE=a GB:737210; contains Pfam profile: PF00197 trypsin and protease inhibitors |
| Mapped public sequence ID | At3g04320 |
| Gene Ontology | |
| KEGG | |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | N/A |
| Target sequence | tacatcagcttcatgacgtcggattacaacatgtggatctgccgaatgcaatatggatct |