| Detail of Probeset 258671_at in Chip ATH1 | |
| Probeset ID | 258671_at |
| Species | Arabidopsis thaliana |
| Annotation | putative vacuolar ATP synthase subunit E similar to vacuolar ATP synthase subunit E GB:Q39258 [Arabidopsis thaliana] |
| Mapped public sequence ID | At3g08560 |
| Gene Ontology | |
| KEGG | |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | N/A |
| Target sequence | cttctcgagtctgccaagcgtaagctccgtcaagactatgaccgcaagctcaagcaggtt |