| Detail of Probeset 258735_at in Chip ATH1 | |
| Probeset ID | 258735_at |
| Species | Arabidopsis thaliana |
| Annotation | low temperature and salt responsive protein LTI6A identical to low temperature and salt responsive protein LTI6A GB:AAC97512 from [Arabidopsis thaliana] |
| Mapped public sequence ID | At3g05880 |
| Gene Ontology | |
| KEGG | |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | N/A |
| Target sequence | gagtacagctactttcgttgatattattatcgccatcctcttgcctccactcggtgtctt |