| Detail of Probeset 258751_at in Chip ATH1 | |
| Probeset ID | 258751_at |
| Species | Arabidopsis thaliana |
| Annotation | low temperature and salt responsive protein (LTI6B) identical to low temperature and salt responsive protein (LTI6B) GB:AAC97511 (Arabidopsis thaliana); supported by cDNA: gi_4325218_gb_AF122006.1_AF122006 |
| Mapped public sequence ID | At3g05890 |
| Gene Ontology | |
| KEGG | |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | N/A |
| Target sequence | atgagtacagccactttcgtagagattattcttgctatcatcttgcctcctctcggcgtc |